Phylogenetic tree for the subfamily Luciolinae. The maximum likelihood (ML) method was applied using randomized axelerated maximum likelihood (RAxML) ver. 8.0.24 (Stamatakis 2014), which was incorporated into the cyberinfrastructure for phylogenetic research (CIPRES) Portal ver. 3.1 (Miller et al. 2010).

Phylogenetic tree for the subfamily Luciolinae. The maximum likelihood (ML) method was applied using randomized axelerated maximum likelihood (RAxML) ver. 8.0.24 (Stamatakis 2014), which was incorporated into the cyberinfrastructure for phylogenetic research (CIPRES) Portal ver. 3.1 (Miller et al. 2010).

Mitogenome sequences have a high potential for possessing single-nucleotide polymorphisms (SNPs) that can be used to identify different strains of an organism bred based on maternal lines. The European honey bee, Apis mellifera ligustica (Hymenoptera: Apidae), with a high-hygienic behaviour (HHB) against the external parasitic mite Varroa destructor has been bred for several years in Korea. To distinguish this strain from low-hygienic behaviour (LHB) strains, the complete mitogenome of the two strains were sequenced using next-generation sequencing techniques to detect SNPs. The two mitogenomes with lengths of 16,449 and 16,426 base pairs (bp) in the HHB and LHB strains, respectively, contained a typical set of genes (13 protein-coding genes, 2 rRNA genes, and 22 tRNA genes, plus one non-coding region), exhibited similar-nucleotide compositions, and had an identical gene arrangement compared to other available A. mellifera mitogenomes. The major differences between the HHB and LHB strains included the length of the intergenic spacer sequences located at the COIII and trnG junction (88 vs. 70 bp) and ND4 and ND4L junction (45 vs. 33 bp) and the presence or absence of a duplicated sequence block (CTTTTTTAAAAAAATAAAAA) in the A + T-rich region. Comparison of the mitogenome sequences from the two strains of A. m. ligustica revealed 23 SNPs in 11 protein-coding genes which were confirmed by sequencing of 10 randomly selected individuals from each strain, indicating the usefulness of these SNP markers for identifying the HHB strain of A. m. ligustica. Therefore, mitogenome sequences are a promising genome source for detecting SNP markers, particularly those in inbred female lines.

Mitogenome sequences have a high potential for possessing single-nucleotide polymorphisms (SNPs) that can be used to identify different strains of an organism bred based on maternal lines. The European honey bee, Apis mellifera ligustica (Hymenoptera: Apidae), with a high-hygienic behaviour (HHB) against the external parasitic mite Varroa destructor has been bred for several years in Korea. To distinguish this strain from low-hygienic behaviour (LHB) strains, the complete mitogenome of the two strains were sequenced using next-generation sequencing techniques to detect SNPs. The two mitogenomes with lengths of 16,449 and 16,426 base pairs (bp) in the HHB and LHB strains, respectively, contained a typical set of genes (13 protein-coding genes, 2 rRNA genes, and 22 tRNA genes, plus one non-coding region), exhibited similar-nucleotide compositions, and had an identical gene arrangement compared to other available A. mellifera mitogenomes. The major differences between the HHB and LHB strains included the length of the intergenic spacer sequences located at the COIII and trnG junction (88 vs. 70 bp) and ND4 and ND4L junction (45 vs. 33 bp) and the presence or absence of a duplicated sequence block (CTTTTTTAAAAAAATAAAAA) in the A + T-rich region. Comparison of the mitogenome sequences from the two strains of A. m. ligustica revealed 23 SNPs in 11 protein-coding genes which were confirmed by sequencing of 10 randomly selected individuals from each strain, indicating the usefulness of these SNP markers for identifying the HHB strain of A. m. ligustica. Therefore, mitogenome sequences are a promising genome source for detecting SNP markers, particularly those in inbred female lines.

The spotted-wing drosophila (SWD), Drosophila suzukii (Diptera: Drosophilidae), is an economically damaging pest that feeds on most thin-skinned fruits. It was originally native to a few Asian countries, including Korea, but is now found in North America and Europe. In this study, we sequenced portions of the mitochondrial (mt) COI and ND4 genes from a total of 195 individuals collected mainly from Korea. We then combined GenBank-registered COI sequences from all ancestral-range and introduced-range populations with our own COI data to assess the worldwide diversity, divergence, and relatedness of SWD haplotypes. A total of 139 haplotypes were obtained from the concatenated COI and ND4 sequences. Most haplotypes were confined to single localities, but 12 of them were found in more than two localities, and one haplotype (SWDCN61) was found from Korea to Canada. A dataset combining GenBank sequences with our own data identified a total of 94 worldwide COI haplotypes with a maximum sequence divergence (MSD) of 5.433% (32 bp). Although most haplotypes were found in only a single country, a few haplotypes were found commonly in China, Korea, and Japan; these occurred at a higher frequency and were often involved in introductions. A rough estimate of genetic diversity in each country showed higher diversity in ancestral distributional ranges, but the invasion over Asian countries seems to have been substantial because haplotype diversity was only 2.35 to 3.97-fold lower in the U.S.A, Canada, and Italy than that in the populations’ ancestral ranges.