Table 1 in Pleocatenata chiangraiensis gen. et. sp. nov. (Pleosporales, Dothideomycetes) from medicinal plants in northern Thailand

Table 1. Primers and PCR procedures used in this study.LocusPrimersPCR proceduresReferencesNameSequence (5 ’-3’)Large subunit (LSU)LR0RACCCGCTGAACTTAAGC94 °C 3 min; 35 cycles of 94 °C 30 s, 52 °C 30 s, 72 °C 1 min; 72 °C 8 min; 4 °C on holdVilgalys and Hester (1990), Rehner and Samuels (1994)LR5TCCTGAGGGAAACTTCGSmall subunit (SSU)NS1GTAGTCATATGCTTGTCTCWhite et al. (1990)NS4CTTCCGTCAATTCCTTTAAGInternal transcribed spacer (ITS)ITS5GGAAGTAAAAGTCGTAACAAGGITS4TCCTCCGCTTATTGATATGCElongation factor-1 alpha (tef1 -α)EF1-983FGCYCCYGGHCAYCGTGAYTTYAT94 °C 2 min; 36 cycles of 66 °C - 56 °C (touchdown 9 cycles), 94 °C 30 sec, 56 °C 1 min, 72 °C 1 min; 72 °C 10 min; 4 °C on holdRehner and Buckley (2005)EF1-2218RATGACACCRACRGCRACRGTYTGRNA polymerase II subunit (rpb2)fRPB2-5FGAYGAYMGWGATCAYTTYGG94 °C 3 min; 40 cycles of 94 °C 20 sec, 55 °C 30 sec, 72 °C 1 min; 72 °C 10 min; 4 °C on holdLiu et al. 1999fRPB2-7cRCCCATRGCTTGYTTRCCCAT